Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BA0700
Clone ID BA0700
Vector pGT2lxr
Project sanger

Sequence tag BA0700
Sequence
GATAATGTGTGCATTTGGTTTTGTCATGGAATACTTTGGTTTCTGCATCTATGGGAATCGAGAGTTTAGCTGGGTATAGT
GGTATACGTGAGTAGAGCATCCGGTATGGGCGCCGGCGGCGGCGGCGGCGGGCGGAGTGAGCTGCGGAGCCTGGAATATG
GTCGGGGAAATGGAAACGAAGGAGAAGCCGAAGCCCACCCCAGATTATTTGATGCAGCTGATGAACGACAAGAAGCTCAT
GAGCAGCCTGCCCAACTTCTGCGGGATCTTCAACCACCTCGAGCGGCTGCTGGACGAAG
Sequence Type mRNA
Unitrap ID UNI577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10511597..10511783 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062078 (Qk) NM_021881 quaking Gene [Source:MGI Symbol;Acc:MGI:97837]

 
Come back to gene ENSMUSG00000062078


For any suggestions or comments, please send an email to unitrap@crg.es