Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSD197
Clone ID CSD197
Vector pGT0Lxf
Project baygenomics

Sequence tag CSD197
Sequence
GTGTCAACATGCAAGATGGCGGCCCATCACCGGCAGAACACAGCCGGGCGGAGGAAAGTGCAGGTTTCTTATGTAATTCG
AGATGAAGTGGAGAAATACAATCGGAATGGAGTCAATGCCCTGCAACTGGACCCAGCACTCAACAGACTCTTCACAGCAG
GTCGAGACTCCATCATAAGAATATGGAGTGTCAATCAGCACA
Sequence Type mRNA
Unitrap ID UNI6267

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119804013..119811542 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032512 (Wdr48) NM_026236 WD repeat domain 48 Gene [Source:MGI Symbol;Acc:MGI:1914811]

 
Come back to gene ENSMUSG00000032512


For any suggestions or comments, please send an email to unitrap@crg.es