Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST206327
Clone ID OST206327
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST206327
Sequence
TCCTCCCGCTTCCTCAGAATGTGAAAGACTATCTACTTGATGATGGGACTCTGGTGGTCTCAGGAAGGGAAGATCCGCCA
ACATGCTCCCAGTCAGACAGTGGTAACGAAGCAGAGGAAACACAGNGGCCCGATGNTGATAGCACAGCCACTCTTACGGC
ACNAGANTTCTCCTGAGTTNAACACTCAAGTCCAANATNCTATNAATTGGCTGGNNNGNAGGGTCTTCCCTANGCTTAAC
TGGAGTGCCCCAAGGGATGCNTACTGNATAGNGATGATCNNTTNCCTGTAGTGTAAAACTCTCAGCGATATCTTTNTGCT
TTTTCAAGAGNTCTGNTTATNTCACNCATGACTTTACACAGCCNTTTATTNATTGCACTGATGACTCTTCAGACCCTTG
Sequence Type mRNA
Unitrap ID UNI24796

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5731855..5763065 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039128 (Cdc123) NM_133837 cell division cycle 123 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Cdc123-001]

 
Come back to gene ENSMUSG00000039128


For any suggestions or comments, please send an email to unitrap@crg.es