Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSD220
Clone ID CSD220
Vector pGT0Lxf
Project baygenomics

Sequence tag CSD220
Sequence
CTCCCACCGCCCTGGAGTCGGTCATCCTGGGCATGGGCTCCCGCTCTGTGGCAGGAGTCTGCATGTCACCCATCACAGTG
ATCAAGACACGCTATGAGAGTGGGACTTACAGCTATGAGAGCATCTATGCAGCCCTGAGGAGCATCTACTGCAGCGAGGG
CCACCGTGGCCTCTTCAGGGGCCTGACAGCAACTCTCCTCCGTGATGCCCCCTTCTCAGGGCTCTACCTGATGTTTTACA
GTCAGACCAGGACCGCAGTGCTGCACGGCA
Sequence Type mRNA
Unitrap ID UNI6269

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120029457..120029962 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032519 (Slc25a38) NM_144793 solute carrier family 25, member 38 Gene [Source:MGI Symbol;Acc:MGI:2384782]

 
Come back to gene ENSMUSG00000032519


For any suggestions or comments, please send an email to unitrap@crg.es