Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST206210
Clone ID OST206210
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST206210
Sequence
TGGCAGGTGAGGAATCAGAACCGGACGGTTTCCCTCCCAGGAATTCAGGCCAGTGGCCATGTACTTGCNTTCGGAAATTG
TACAGACANTGACATGTTGGAAGAAGATGCTGAAGTCTACGAACTTCGGTCCAGGGGAAAGGAGAAGGTTCGAAGAAGCC
GCATCGAGAGATAGACTTGATGACATTGTTATATTAACCAAAGATATCCAGGAAGGAGACACTCTAAACGCAGTAGCCCT
TCAGTACTGCTGTACGCCCTCGGNGNATAAGTTGTCGGACACTCTGAATACATCTGGNTACACATCTGCCTACACATCTG
CCTACACAGCCCGAGCAGGAAACAGAGCTTTAATATATTCGGTGCAGCTTTTCCTGCCTAGAGATAACTAAAACTGCACT
GCGGCGTTAATGGCATTTTACTTCCGATAAAAATAAAGCCTTTTTAACCCGGGTAAGTTA
Sequence Type mRNA
Unitrap ID UNI22303

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81804015..81807792 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035840 (Lysmd3) NM_030257 LysM, putative peptidoglycan-binding, domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1915906]

 
Come back to gene ENSMUSG00000035840


For any suggestions or comments, please send an email to unitrap@crg.es