Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST206190
Clone ID OST206190
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST206190
Sequence
AGGAAGTTACTGGGGACCTGCAGCTGGATGGCAGGATCGTGTGGCAGGAAACTGGACAAGTCTTCAACTCACCCAGCGCC
TGGGCCACACACTGCAAGAAGCTCGTCAACCCAGCCAANAAATCTGGCTGNGGCTGGGCCTCTGTCAAGTACAAGGGCCA
GAAGCTGGACAAATACAAGGCCAGCCTGGCTTCGCCGGCACCAGCTACATATGCCTGTAGCTACGGCCGATGAGAGTCCC
ACCAGTGAAGGGGAGGAGGAAGAACTGCTGTTGGAGGAGGAGGAAGAAGATGTGCTGGCTGGGGTCTCATCAGAGGACAA
AGGCCACAGACCCCCTGGGAAGGGTTCCTTGGAGCCAGAGGCCACACCCCCAGGGAAGCGTATGGACAAGGTGCCAGTGC
CCATCCGTTACTGCATGCTGGGCAGCCGAGACTCCGCCAGGAACCCCCACACTCTGGTAGAAGTAACATCCTTTGCTGCC
ATCAACAAGTTCCAGCCATTCAACGTGGCCGTTTCCAGTAAATGTGCTGTTCCTCTTGGACTTCCACTGTCACCTG
Sequence Type mRNA
Unitrap ID UNI24798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56149703..56151711 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003199 (Mpnd) NP_080806 MPN domain containing Gene [Source:MGI Symbol;Acc:MGI:1915297]

 
Come back to gene ENSMUSG00000003199


For any suggestions or comments, please send an email to unitrap@crg.es