Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSD228
Clone ID CSD228
Vector pGT0Lxf
Project baygenomics

Sequence tag CSD228
Sequence
TTGCTCTTCGGCAGTCCTCCTTCCCAACATGGCGCAGTCGATTAACATCACGGAGCTGAATCTGCCACAACTGGAAATGC
TCAAGAACCAGCTGGACCAGGAAGTGGAGTTTTTGTCCACGTCCATTGCTCAGCTCAAGGTGGTCCAGACCAAGTACGTG
GAAGCCAAGGACTGTCTGAACGTGCTGAACAAGAGCAACGAG
Sequence Type mRNA
Unitrap ID UNI6273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102156592..102156965 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001289 (Pfdn5) NM_027044 prefoldin 5 Gene [Source:MGI Symbol;Acc:MGI:1928753]

 
Come back to gene ENSMUSG00000001289


For any suggestions or comments, please send an email to unitrap@crg.es