Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST206060
Clone ID OST206060
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST206060
Sequence
CTGAGAGTGCCTGGTGAAGAATGTGATGGGATCACTAGCATGTCTACGGAGAGCGGCCCTGGGACAAGATTGAGAAATCT
GCCAGTNATGGGGGATGGACTAGAAACCTCCCAAATGTCTACAACGCAGGCCCAGGCCCAACCCCAGCCAGCAAATGCAG
CCAGCACCAATCCTCCACCCCCAGAGACCTCCAACCCTAACAAGCCCAAGAGACAGACAAACCAACCTGCAATATCTGCT
CAGAGTGGNGCTCAAGACACCTATGGAAACACCAGTTTGNGTGGCCTTTCCAGCAGCCCGTGGATGCCGNNAAGCTGAAC
CTCCCTGATTACTATAAGATTATTAAAACACCCATGGATATGGGAACAATAAAGAAGNGNTTGGAAAACAACTATTACTG
GAATGCTCAGGAATGTATCCAGGACTTCAACACTATGTTTACAANTTGTTACATAAATAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23478

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32362522..32366682 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es