Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST205854
Clone ID OST205854
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST205854
Sequence
GACTGAGGCATGGAGAGTAGAAAACTGATTTCTGCTACAGACATTCAGTACTCTGCCAGTCTGCTGAACTCCTTGAATGA
ACAGCGTGGCCATGGTCTCTTTTGTGATGTTACTGTTATTGTGGAAGACCGAAAATTCCGGGCCCATAGGAACATCCTTT
CAGCCTCGAGTACATACTTCCATCAGCCTCTTCTCAGTTGCTGGGCAAGTTGTTGAACTAAGCTTTATAAGAGCTGAGAT
TTTTGCAGAAATTCTGAACTATATCTACAGTTCCAAAGTTGTCCGTGTTAGAGCAGATTTGCTTGACGAGTTAATTAAAT
CAGGGCAGTTACTAGGCGTGAAAAAAA
Sequence Type mRNA
Unitrap ID UNI24801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35545390..35545726 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048047 (Zbtb33) NM_020256 zinc finger and BTB domain containing 33 Gene [Source:MGI (curated);Acc:Zbtb33-001]

 
Come back to gene ENSMUSG00000048047


For any suggestions or comments, please send an email to unitrap@crg.es