Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST205598
Clone ID OST205598
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST205598
Sequence
GACTGAGAGTTTGGATCCCTCCCCAGGCACTAAAGATGTTATGGCAGAACCTCCATCAGTTTGGCCAGAAGTTGGTTCGC
CGGCGGCCCCTGGCGGCAAACGAACAGTCTGAGTCTTCCTTGTCTCGATGTCTGACCACTTTGGACCTGGTGTCCTTGGG
TGTGGGCAGTACCCTGGGTGCAGGCGTGTATGTCCTGGCCGGGGAGGTGGCCAGAGAGAAAGCTGGACCGTCCATCATCA
TCTGCTTCTTAATTGCTGCCCTGTCTTCAGTGATGTCAGGACTCTGTTATGCGGAGTTTGGGGCCAGGGTACCATGCTCG
GGTTCCGCATATCTCTACAGCTATGTCACAGTGGGCCAGCTGTTGGCTTTCATCACTGGCTGGAACTTAATACTCAACTA
TGTCATTGGTGAGGAGATGGGGGCAGGGTTTTATATAAGTAGGCCAGGTTGGTCTTGAACTCTCTATGTTAACTGAGAAT
GACCTGAATTTTGCCTCTACCTCCTAAAAATGGGATCACGGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI11841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3163779..3323584 515
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054753 (AU018091) NM_001004153 cationic amino acid transporter 5 [Source:RefSeq peptide;Acc:NP_001004153]

 
Come back to gene ENSMUSG00000054753


For any suggestions or comments, please send an email to unitrap@crg.es