Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST205569
Clone ID OST205569
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST205569
Sequence
GACTGAGGTCGCCCGGCGTTCCTGCGCAAATTCAAACAGAGAGAAGTCCGAGCAGTCAGGTCAGTGCTGCATTCGCCATC
ATTTTCATCAGGTCTATGCCGCAGTCCGCCTTCCCGCCGCTTCCCCTTCGCTCCGCCCAAGGGGCCTACGGATGTTACCA
AGTTGACACCACCTTTCACATGAAGAAAACATTTAAATAAAACAAGATTCTGAAACAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI24806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 91434049..91458168 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035150 (Eif2s3x) NM_012010 eukaryotic translation initiation factor 2, subunit 3, structural gene X-linked Gene [Source:MGI (curated);Acc:Eif2s3x-001]

 
Come back to gene ENSMUSG00000035150


For any suggestions or comments, please send an email to unitrap@crg.es