Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSF008
Clone ID CSF008
Vector pGT0Lxf
Project baygenomics

Sequence tag CSF008
Sequence
TTTTTGCAAACGTTTTTTTTTTTCATTGCTAGTGTGAACACCTTGGTGAATAAAACAATTGAAGATACATTAATGACTGT
AAAACAGTATGAAAATGCCAGAGTTGAATATGATGCGTACCGCATA
Sequence Type mRNA
Unitrap ID UNI6287

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84313882..84319638 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074513 (Arfip1) NM_001081093 ADP-ribosylation factor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1277120]

 
Come back to gene ENSMUSG00000074513


For any suggestions or comments, please send an email to unitrap@crg.es