Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST204169
Clone ID OST204169
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST204169
Sequence
TGAGACCATCTGAGGAAAACTTGGNTGAAGAAAGTGTGATTTTAACGCTGGTCCCCTTTAAGGAGGAGGAGGAGCCAAAC
ACAGACTACGCTACACAATCAAATGTTTCTTCTTCAACCTTAGACCACACACCACCAGCCCGTTCTCTGGTGAGGCATGC
TGGAATCAAACACCCAACCAGAACCATACCAAGCACCCTGTCCTCCGCCCAGCCTGCCTCCTATTAGGGACGTGTCCCGG
AACACCTCTTCGGGAGTGGTGTCGGTATCATAACTTGAGTACGGATGGCAAGAAAGTTGAGGTCTATTTGAGACTTCGGA
GACACTCCTATTCTAAACAAGAATGTTATATTCCCAATACATCTCGGGAGGCCAGAATGAAGCAGGGTCCCAAGAAATCC
AAGATAGTCTTCAGAGGAATCGGGCCTCCAAGCGGGTGCCAAAGGGAAAAAGGAGGAGAGTGGTGTCCTGGAAATTCTAA
CTTCACCTAAGGAGTCCANATTGCAGCCTGGGCAAAGATTGCCATGAGAAGCAGCTCAGTCAATGTCTAAGAATCGATGT
CCTCTTCC
Sequence Type mRNA
Unitrap ID UNI11427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48311693..48315995 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072419 (Dppa2) NM_028615 developmental pluripotency associated 2 Gene [Source:MGI Symbol;Acc:MGI:2157523]

 
Come back to gene ENSMUSG00000072419


For any suggestions or comments, please send an email to unitrap@crg.es