Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSD297
Clone ID CSD297
Vector pGT0Lxf
Project baygenomics

Sequence tag CSD297
Sequence
GATGGAGGAGGCAGCGCGGCAGCGGGTTCCGTTCCGGGCCGAGGCTGGACGCGGAAAAGTTGCGGGGCGGCGAGGAGCAG
CCCGGAGACGGGCAGCGAGGGCGACATCGAGCCGGGGACTGGCGTCTGAGGACCAGCCATGGACGACCTC
Sequence Type mRNA
Unitrap ID UNI5902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115956730..115956876 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029528 (Pxn) NM_011223 paxillin Gene [Source:MGI (curated);Acc:Pxn-001]

 
Come back to gene ENSMUSG00000029528


For any suggestions or comments, please send an email to unitrap@crg.es