Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST203925
Clone ID OST203925
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST203925
Sequence
GGCCGAGCCTGGATTTNAAGAAAGAGCCATATGGCCCCTGCAGACCTGGCCTCGGAGGGTCCCAAGCTTGAGGACCCGCC
GGCCCCCCACCTCTTTGGAAAGGTCCCCTATTGGATCCAAGCACTGCTTTTCTCAACCAGTCCAATCTCCCCGGCCCATG
AAACTGAAATATAAGAGTCATGCATGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI24845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130463401..130463722 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037703 (Prosapip1) NP_922936 ProSAPiP1 protein Gene [Source:MGI (curated);Acc:Prosapip1-002]

 
Come back to gene ENSMUSG00000037703


For any suggestions or comments, please send an email to unitrap@crg.es