Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST203824
Clone ID OST203824
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST203824
Sequence
ATAAGCTGGAACAGATCTATGAATGCACTGACACTGAANATGTCTGCATTGTGGAGAGATTGTTCTCAAGCAGCTTGGTG
GCCATTGTCAGCCTNAAAGCTCCCAGGAAGCTGAAGGTTTGNCATTTTAAGAAGGGAACTTGAGATATGCAACTACAGCT
ACTCCAACACTATCCTGGCTGNGAAGCTGAACAGGCAGCGGNATCATTGNGTGTCTGGAAGAGTCNNTCTACATACACAA
CATCCGGGACATGAAGGTACTTCATACCATCCGAGAGACACCCCCAAACCCTGCAGGCTTGTGTGCACTGTCAATAAACA
ATGACAACTGCCTACTTGGCGTATCCAGGGAGTGCGAGCATTGGAGAGGTGCAGGTCTTCGACACCATTAACTTGAGAGC
TGNAAACATGATCCCAGCTCATGATAGTCCCTTANCAGCCCTGGCTTTTGATGCAAGTGGNGACCAANNCTTGCCACTGC
TTCTGAG
Sequence Type mRNA
Unitrap ID UNI22851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143114212..143135576 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029578 (Wipi2) NM_178398 WD repeat domain, phosphoinositide interacting 2 Gene [Source:MGI (curated);Acc:Wipi2-001]

 
Come back to gene ENSMUSG00000029578


For any suggestions or comments, please send an email to unitrap@crg.es