Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSD329
Clone ID CSD329
Vector pGT0Lxf
Project baygenomics

Sequence tag CSD329
Sequence
GGGCAGGACCGCCTCAGGAAAGTGCTTTAGGATTTACAGTAAAGAGTTTTGGAGCCAGTGTATGCCTGACCATGTGATCC
CAGAGATTAAGAGAACTAGTTTGACATCTGTAGTTCTGACATTAAAGTGCCTTGCCATACATGATGTCATAAGGTTTCCA
TATTTGGATCCACCTAATGAGAGACTTATTTTGGAAGCACTTAAACAACTTTATCAGTGTGATGCTATTGACAGGAGTGG
CCATGTGACAAGATTGGGGTTATCCATGGTGGAGTTCCCTCTCCCCCCACATCTGACGTGTGCAGTGATCAGGGCTGCTT
CTCTTGACTGTGAAGATTTGCTGCTTCCAATAGCAGCAATGCTATCTGTGGAAAATGTCTTCATCAGACCT
Sequence Type mRNA
Unitrap ID UNI6310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86598382..86602821 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018425 (Dhx40) NM_026191 DEAH (Asp-Glu-Ala-His) box polypeptide 40 Gene [Source:MGI (curated);Acc:Dhx40-001]

 
Come back to gene ENSMUSG00000018425


For any suggestions or comments, please send an email to unitrap@crg.es