Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST203694
Clone ID OST203694
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST203694
Sequence
ATCAGACATTCACAGCAGATAGGCGATGGCTGGGAATGGAGAACAGCCAAGGAATGTTCTGATGGCTACATGTGCNAAAC
NCAGTTTCNAATAAAGAATGAGGACCTTGACACCACATGCCAGTGTGCTCACATGTCTCCCTACAGAGGAGAANTTAGAG
CTACCAATGGATGATTCTGAAGTGACGAGACCTGCAGCGGTGGCAGAAGTGATTANACATGAGTATNATGTCTNATACTC
TTGTANNTACCAAGCGCCGGATCTTTACTTTAGGGCNCAGCTTTTTANATGGGAGACCGNTANCTNTGGAGGATATATGG
GANAGGTGTTCNTGAGTNCTATAAGCCNAGGCTGCTCCAGGGACCGNGGGATACCATCACCCAGNNGGAACNTNCAATAN
CTTGGGCAACCATTTTTTTGTTCTACATCCCTNCNAGANAAATGAAATACATGACCTGCTGGGC
Sequence Type mRNA
Unitrap ID UNI17938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 91076923..91347973 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021619 (Atg10) NM_025770 autophagy-related 10 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914045]

 
Come back to gene ENSMUSG00000021619


For any suggestions or comments, please send an email to unitrap@crg.es