Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSD334
Clone ID CSD334
Vector pGT0Lxf
Project baygenomics

Sequence tag CSD334
Sequence
GGTGCGGAGCCGTGGAACCGCGTGAGGATCCCCCAGGCGGGGAACTGCAGCACGCTGACCGTGCGGGACCCCAGCGCCAC
CCTGGATATCTGCACTGCAGCTGTCACTAAAGGGTGCCACCTTGTCACACAGTCACTCAAGAGCCAGACCTTGGATGCGG
AAGTAGATGTGTTATGCTCAGTTCTCTACAGCAATCACAACAGGTTGGGCCACCACAAGCCCCATTTGGCCCTCAGA
Sequence Type mRNA
Unitrap ID UNI6312

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 44724497..44727292 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036208 (BC027231) NM_145972 Putative uncharacterized proteincDNA sequence BC027231 ; [Source:UniProtKB/TrEMBL;Acc:Q8R2U2]

 
Come back to gene ENSMUSG00000036208


For any suggestions or comments, please send an email to unitrap@crg.es