Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST203138
Clone ID OST203138
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST203138
Sequence
GACTTGAGATGCTCTGTGTNTNGACGCTCAGCANGCTCTGAAGNCCNNNNGACNNNNNNTACAANNNNNNTATGAGAACT
GGCAGCCAAGGGCTCGGTACAAGCAGAGCCTCGACCCTACTGTGGATGAAGTCAAGAAACTTTGCACATCTCTGCGCCGG
AACGCCAAGGAGGAACAGGGTCCTTTTCCACTACAATGGCCACGGGGTGCCCAGGCCTACAGTGAATGGAGAGGTCTGGG
TCTTCAACAAGAACTACACTCAGTACATCCCTCTGTCCATATACGACCTGCAGACGTGGATGGGCAGCCCATCCATCTTT
GTCTACGACTGTTCCAATGCTGGCCTCATCGTCAAGTCCTTCAAACAGTTTGCACTGCAGAGGGAGCAGGAACTAGAGGT
AGCTGCGATTAACCCAAACCATCCACTTGCCCAGATGCCCTTGCCTCCCTCAATGAAAAACTGCATCCAGTTGGCAGCGT
GTGAGGCACACGAGCTGCTGCCCATGATCCCTGACCTCCCAGCCGACCTGTTCACATCCTGCCT
Sequence Type mRNA
Unitrap ID UNI1601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119532590..119617698 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025583 (4932417H02Rik) NM_028898 RIKEN cDNA 4932417H02 gene Gene [Source:MGI Symbol;Acc:MGI:1921620]

 
Come back to gene ENSMUSG00000025583


For any suggestions or comments, please send an email to unitrap@crg.es