Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST202783
Clone ID OST202783
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST202783
Sequence
GGACATTTGCTTTCCTGTCTGGTGGCCGGGGANNGGCCNAATGCCNTGGANTCNTCANATNNNCCCGANNCCCTGTAACN
TTCANANGCCNANCCGACGGCNTGNNNCTTGCAAANGNGCNCAANCNCCTTGACNCTCTNNTTGCAAGGCAAAGTTGGAT
CGTGACCTCCCGATTTACTATTATTCTAGATCGAAGACTGGATACATGGGCTTCCCTCAAAATTTCCCTCCAGAAAATCT
CAANAATCCAGNGGGTTCAGTTCCCAGCACTCACATGGCANCTCACAAACATCTCTAACTCCAGTTCCAGNGGATTTGAC
CTCTCTCCTGACTTCTGTGGGCTCCTGCATGNGGTACACAGATTTATACTCAGGCTCACATATATGCATAAAATA
Sequence Type mRNA
Unitrap ID UNI24869

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57401688..57406169 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031139 (Mcf2) NM_133197 mcf.2 transforming sequence Gene [Source:MGI (curated);Acc:Mcf2-001]

 
Come back to gene ENSMUSG00000031139


For any suggestions or comments, please send an email to unitrap@crg.es