Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC405
Clone ID YHC405
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC405
Sequence
TTGGCTGCCCCGGCGGCCTCCTCGGCAGTCATGGCTCCTCGGATGTGATAGTTTCCCCCGCCCCCTCGCGTAGGACGCGG
CGGCGGGGCGGCGGTGGGAAGCCTAACTTTATTGTTCCCCCGGCCCGTCTCCCGGCGCGTCCTCAGGATGCTCGGGAGCT
GAGCGCCGGGGGCGGCGGAGGGTCGCGGTCTGTCCGGGCCCTCGCCTCGGAGCGCAGGGCCAAGGGAGGGAGTCACGATG
TCAGGTAGCCGCCAGGCCGGCTCGGGTTCCGCTGGGACGAGCCCCGGCTCCTCGGCCGCCTCCTCGGTGACTTCCGCCTC
CTCGTCCTTATCCTCGTCTCCGTCGCCGCCGTCCGTGGCGGCCTCGGCGGCGACGCTGGTGTCCGGCGGCGTGGCTCCGG
CCGCGGGCTCCGGCGGCCTCGGCGGCCCGGGGCGGCCTGTGCTGGTGGCGGCCGCGGTGTCTGGCCATCACGAGA
Sequence Type mRNA
Unitrap ID UNI6329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 161162332..161162804 466
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040782 (Rfwd2) NM_011931 ring finger and WD repeat domain 2 Gene [Source:MGI Symbol;Acc:MGI:1347046]

 
Come back to gene ENSMUSG00000040782


For any suggestions or comments, please send an email to unitrap@crg.es