Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST202256
Clone ID OST202256
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST202256
Sequence
CGATCTGGTTAGTCAACAGAAGAGTTTACCCAGCTGGAATTCTTCATGTGGTTACTTGTTCATGCAAATGAGTAGCAGAG
GCTTAAGATAGTAGAGAAAAACACTCTGTATTAAAAGGACTTTGTATTTTTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101410204..101410335 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es