Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST202215
Clone ID OST202215
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST202215
Sequence
GACTGAGCCCCCCCATCAGTCCCTTCTCAAGCTCCTAGACACAACTGTGGACTTGGGGACCAGCCGAGCACCCCCAGAGC
ACTAGAGGAGCCCCTGCTGCCTGCCCTGCCTCACCCTGCCCCACACGAGGCCCAGCGGCCCCGGGCTGCATCAAGTGGAG
GAGGAGGAGGCGGAGGAGGGTGGCACCATGGGCCCTGGNCCCGTGCCCTCCATGCCCGGGGGATGAAGACACCTGCCTGC
CATGGACAGNCCGTGCCAGCCGCAGGCCCTGAATCAAGCTCTC
Sequence Type mRNA
Unitrap ID UNI24888

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27950476..27950749 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058709 (Egln2) NM_053208 EGL nine homolog 2 (C. elegans) Gene [Source:MGI (curated);Acc:Egln2-001]

 
Come back to gene ENSMUSG00000058709


For any suggestions or comments, please send an email to unitrap@crg.es