Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC292
Clone ID YHC292
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC292
Sequence
CAAGCGCGAGCCGCGAGCGTGGGTTATCTCGAGACAGCCGGGCTGCGGGCTGCGGAGCGTGCGGGTCTGAGGCCTGCGTT
CTGCTAGCTCCAGCGGCTCACAGGCCGAGGTAACGAGGCGCAGCAAGCCGAGCCTCCCCGCTCCCCCGGACAGCGTGGGC
CATGGAGACTCAAGTGCTGACGCCGCATGTCTACTGGGCTCAGCGACACCGCGAGCTGTATCTGCGCGTGGAGCTGAGTG
ACGTGCAGAACCCTGCTATCAGCATCACAGACAATGTGCTGCATTTCAA
Sequence Type mRNA
Unitrap ID UNI6338

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64858283..64869511 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033629 (Ptplad1) NM_021345 protein tyrosine phosphatase-like A domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1889341]

 
Come back to gene ENSMUSG00000033629


For any suggestions or comments, please send an email to unitrap@crg.es