Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST201748
Clone ID OST201748
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST201748
Sequence
TCCTGGGAAGACAGACATTTTATCTGCAATTACCATNGGTGGAGCTCCATGCCCACTTGAATGGNTCCATTAGTTCCAGT
ACCATGAAGAAACTGATAGCCAAGCAGCCACATCTTAACGTTCATGGTCACATGACCATGATTGACAAGGGGAAGAAAAG
GACTTTACAAGAATGTTTCCAGATGTTCCAAGTTATACATCAGCTTACTACTAGTGCTGAGGACATCCTGATGATCACAA
AAGACGTCATTAAGGAATTTGCAGATGATGGTGTCAAGTACCTGGAGCTGAGGAGCACTCCCAGAGAAGAAAATGCTACT
GGAATGACTAGGAAGACTTACGTGGAATCCGTCCTTGAAGGCATAAAAC
Sequence Type mRNA
Unitrap ID UNI24899

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 120968001..120971896 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027259 (Adal) NM_029475 adenosine deaminase-like Gene [Source:MGI (curated);Acc:Adal-002]

 
Come back to gene ENSMUSG00000027259


For any suggestions or comments, please send an email to unitrap@crg.es