Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST201733
Clone ID OST201733
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST201733
Sequence
TGCACGCGTTCTTGTACGTCCCCGGGANGCCTANACGNGGTGGCGCCTGTGCCNATNTGCTGTGGGAGCCGGCTACCTCG
TGGAGAGGACAGCCTGAGGACGCCAAGGACTTTCTTTCAAAAGGAANACTAGACTTCCTCACCAAACAGATGGAGAAAAT
CCAGCCAGCGGCTGCAGGAGAAGCATGCCATGAAGCAGGCTGTCATGGAAATGATGAGCCAGAANATTCAGCAGCTCACA
GCCCTGGGGGCAGCGCAGGCCACGGTCAAAGCCTGAGAGTGCACTGCAGAAATGAAGCAGAGTGAGGGACCCTTCTTCAA
GGGGCCTGGGACTTTTTCCGGCAATGGCCTCCTGGGAAAGTGGCCTGGGAAGAGAGTGTTTTGTGTTTAATGTTAATAAA
TGTGACCGCTGCGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI24688

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102158954..102161921 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001289 (Pfdn5) NM_027044 prefoldin 5 Gene [Source:MGI Symbol;Acc:MGI:1928753]

 
Come back to gene ENSMUSG00000001289


For any suggestions or comments, please send an email to unitrap@crg.es