Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC246
Clone ID YHC246
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC246
Sequence
GAAACAATAGAGGCCGCGCGCGCGGAGCGGAGCGCTCGTAGCCTCCCCGCCCCTCCTGCAACGCAAGACCCCGGGATCCC
CCAACCCCTCCCGGCTCTCCTGCCGCCATGGCTGACAAGGAAGCGGCCTTTGACGACGCAGTGGAAGAACGGGTGATCAA
CGAGGAGTACAAAATATGGAAGAAGAACACCCCTTTTCTTTATGATTTGGTGATGACCCATGCCCTGGAGTGGCCCAGCT
TAACTGCCCAGTGGCTTCCAGATGTG
Sequence Type mRNA
Unitrap ID UNI6350

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 129011746..129012584 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057236 (Rbbp4) NM_009030 retinoblastoma binding protein 4 Gene [Source:MGI (curated);Acc:Rbbp4-001]

 
Come back to gene ENSMUSG00000057236


For any suggestions or comments, please send an email to unitrap@crg.es