Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST201476
Clone ID OST201476
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST201476
Sequence
GGAGACAGTGCTGCAGCTCCAGGANTGNAGCATCTTCATCAAGANTATTAACACCATCCATGACACTAAANAGGGGCAAC
AAATCCTACAGCAGCCACATACNAGAANAGANTNGACTNTGTTTNCNGTTGTGTACANAGACAGNGGAAACATCACTTCA
TTTACACGAGTGCCTGNAATNTNTACANAAAGAGATAAGAGGGATCCTGAGATGGAACTGGCCAAGATGATAATGCTGNT
TTTATATCAGTCCACCATGAGCTCCAGAAACCTCCGGGACTGGGAGCAG
Sequence Type mRNA
Unitrap ID UNI24906

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109136269..109141214 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066306 (Numa1) NM_133947 nuclear mitotic apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443665]

 
Come back to gene ENSMUSG00000066306


For any suggestions or comments, please send an email to unitrap@crg.es