Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST201446
Clone ID OST201446
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST201446
Sequence
GACTTGAGGTCTGCTCAACCCCTGAGACGTGCGGGNANCTCCTCACCGACGGAGACNTGGTTTGCNTGCANTCCTCCGCA
ACCGCGCACCNTGTGGAAAGCGGAAAGANCAGCACCTTGAAACCTGTGCCTNTGGAAGTGAAATGGGCCTCTCTTCCCNT
TTGCAGTCTTGCAAGGCAGGAAGTACACTGCATCTTTACCAGCAACAGCCACAGTTCTGTGGTGTTACAGGGCTTTGACC
AGCTTCGGCTTGATGGATTGCTTTGTGATGTGACACTGATGCCAGGTGATACAGATGATGCTTACCCTGTGCACAGAGTC
ATGATGGCATCTGCTAGTGACTACTTCAAAGCTATGTTCACAGGTGGAATGAAAGAACAAGAGCTGATGTGCATTAAGCT
TCATGGCGTGAGCAGAGNGGGTCTACGGAAAATTATTGATTTCATCTATACTGCAAAGCTTTCTNTTAACATGGACACCC
TTCAGGATACGCTGGAAGCCGCCAGCTTTCTTCAGATTCTTCCGGTTTTAGACTTCTGCAAAGTGTTTCTCATATCTGGG
GGAA
Sequence Type mRNA
Unitrap ID UNI20187

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22824483..22838693 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036782 (Klhl13) NM_026167 kelch-like 13 (Drosophila) Gene [Source:MGI (curated);Acc:Klhl13-001]

 
Come back to gene ENSMUSG00000036782


For any suggestions or comments, please send an email to unitrap@crg.es