Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST201348
Clone ID OST201348
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST201348
Sequence
GACTACAGGAGGACTCGGTAATCCTCTGGGAGTGGAGTTACAGCTGGTTGAGAGCCACGTGAGTGCTGGGAATCAACCTT
GGAACCTCTGGAAAAAGCGGCTGAGTCAACCACAACCCATCGCTCAAGCCCCATTGCTGGGCCCTGGTGACAACGCATGT
CAGTCCTGCCTCAGCCCCCTGAATGCATGTTTACAGATGTGCACCANAGCACCTGACTCAAGTTTTAAAC
Sequence Type mRNA
Unitrap ID UNI23554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96820873..96821099 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078700 (D030028A08Rik) RIKEN cDNA D030028A08 gene Gene [Source:MGI Symbol;Acc:MGI:2441931]

 
Come back to gene ENSMUSG00000078700


For any suggestions or comments, please send an email to unitrap@crg.es