Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC203
Clone ID YHC203
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC203
Sequence
CAGTCAGGCAGGGGGAGCCGCCGAGAGCGGATGGCGGCAGCAGTAGCGGGCCCACTCGCCGCCGGGGGTGAGGAAGCTGC
AGCTTCAGTGTCCTTGCCAGGGTCTCCTGGTCTACCTGGGAGCCGTAGCGCAGAACGAGCCCTAGAGGAGGCTGTGGCCA
CCGGGACCCTGAACTTGTCCAACCGGCGTTTGAAGCACTTCCCCCGGGGCGCGGCCCGCAGTTACGACTTGTCAGACATC
ACCCAGGCT
Sequence Type mRNA
Unitrap ID UNI679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138070405..138070653 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029720 (Lrch4) NM_146164 leucine-rich repeats and calponin homology (CH) domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1917193]

 
Come back to gene ENSMUSG00000029720


For any suggestions or comments, please send an email to unitrap@crg.es