Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST201076
Clone ID OST201076
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST201076
Sequence
GACTGAGGGCTTGCACTTTTAGCTACACCTGCTTATCGTCGAGCAGGACAAAGTGCCCTGGAAGGTGGAGAGAGAGGCAT
CAGTAGCAAAGGATCCAGGCAAGAAGGGGTCCAGCCATTGTTCTTGANACANAAACTCAGAGCAGATCAACAGGAANAAA
TGGCTGCTTCTCCAGGTCTGTTGACATTCGGGGATGTGGNTTTGNACTTCTCCCAGGAGGAGTGGGAATGCCTGGACTCT
GCTCAGAGGGCTCTGTACATTGATGTGATGTTGGAAAANTACATCAACTTGGTCTCTGTTGGTGAGAACATTTTTCTTGC
ANAATTCCATTGTTTGTATTTACCTGGNTTATAATGTATAAATTCTCTGATACTGTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI24917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21846170..21858119 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067928 (Zfp760) NM_001008501 zinc finger protein 760 Gene [Source:MGI Symbol;Acc:MGI:2679257]

 
Come back to gene ENSMUSG00000067928


For any suggestions or comments, please send an email to unitrap@crg.es