Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST200953
Clone ID OST200953
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST200953
Sequence
CTTCCCTCTACCGGTGCTGGCAGCTGACTACTGAGGCCCTGCCCAGNGCCTAGGTGGNCTNCAGNANGGNCCNGTCCAAC
ATGNGGCGCCGNGTGGACNNGANTGNCAGGCGCCNNNGGCTCCGCGCATNGTNNANANCTCNTTGNANAGGAGCTATCCC
ANCAGCCATTGGCTTCCTCTTTCTTGGTGACCTTTNTTTTGAGACATCATNTATTATTTATATGNGTATATGACTGTACC
ACTTGTGNGCCTATACCTATGGAGGCCAGAAGAGCCTNTCCTTGCATNATGTGGGTTCCAGGNATTGAATTTAAGTTACT
AGGCTTGGTGGCAAGGGCCTTGATTTGCTGAGCTATCTTGCCAACCCAGTTCTAAAATATTGCATTATTCTCTAATAATG
CATAATTAGGTAGTGATATTATCTAATAAAAGATGTATGCGTCTCTGTGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI24924

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 43906220..43906519 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053128 (Rnf26) NM_153762 ring finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:2388131]

 
Come back to gene ENSMUSG00000053128


For any suggestions or comments, please send an email to unitrap@crg.es