Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC182
Clone ID YHC182
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC182
Sequence
ACAAAGCACGGAAGACTTACGAACGCCTTGTTGCCCAGTTCCCCAGTTCTGGCAGATTCTGGAAACTGTACATTGAAGCA
GAGATTAAAGCTAAAAATTATGACAAGGTTGAAAAGCTATTTCAAAGATGCCTTATGAAGGTTTTGCACATTGATTTATG
GAAGTGTTATCTTTCATACGTCAGAGAAACCAAGGGTAAACTGCCCAGCTACAAAGAAAAAATGGTTCAAGCTTATGACT
TTGCACTAGATAAAATTGGAATGGAAATTATGTCCTATCAGATTTGGGTGGATTACATCAATTTCTTAAAAGGAGTGGAA
GCTGTAGGATCTTATGCAGAAAATCAGAGAATAACTGCTGTCCGAAGAGTTTATCAACGAGGTTGTGTTAATCCAATGAT
CAACATTGAACAACTCTGGAGAG
Sequence Type mRNA
Unitrap ID UNI6362

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104449261..104486987 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027176 (Cstf3) NM_145529 cleavage stimulation factor, 3' pre-RNA, subunit 3 Gene [Source:MGI (curated);Acc:Cstf3-001]

 
Come back to gene ENSMUSG00000027176


For any suggestions or comments, please send an email to unitrap@crg.es