Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST200663
Clone ID OST200663
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST200663
Sequence
CCTTTGTGCGAGTTCCNGTTAACGCCNTGTGCCNNTGCGCCACACTCNACACAAAGCCTTNCTCNCANCNNCTGCNNACT
GGAAAAAGGCGTTTCTCTCCCCTGTTGGANNGNGANNGTTTCTTGGANATTGTATTANANNGTTGGCAGGAAGGTAACCG
TTCTTTCAGCCAGACGACGAAGTGGTCGGAATTCTGCCTTTGGATTCCGAAGACCCCGGGCTCTGTGAGGTTATTCGAGT
ACATGAGCATTACCTGGGTACT
Sequence Type mRNA
Unitrap ID UNI24932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91707466..91709119 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058240 (Cryzl1) NM_133679 crystallin, zeta (quinone reductase)-like 1 Gene [Source:MGI (curated);Acc:Cryzl1-003]

 
Come back to gene ENSMUSG00000058240


For any suggestions or comments, please send an email to unitrap@crg.es