Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC146
Clone ID YHC146
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC146
Sequence
GTGACGCCTGGATGGCCATCAGAAGAGGAGGTGGGAAGTGATGAGGAGTACCTTGCTCTGCCCACCAGGCTGACTCAGGT
CTCTAGTTTGGTGTCCTACTCAGGTGCCAGGCCCTCCTTTGTGAACCTACACACTGGGGCTGCTGAGGAACACAGTTCAC
TACAAGTCTCAGACAGTGACAAGCCAGCCTCCCCCACATTGGACTCCAGCCACAGGAAGCATCCTTCTGGAACTTCCTTT
CAAGGGCCTGTGGGCCAGAACCCCTGCTTCAGGCATTCTATCCAGCCCCAGGACTCTAGAGGCAAAAGTAGTCTGATGAG
TAACCAGACCCTCGGGGTCTCTTCAAAACCACTGAAAACTCAGCCCGCCTCAAAAGCCATGACGGACAGGCGGCTGTTCT
CCGAGCTAGTAGCTGGAGAGACACTTCCCA
Sequence Type mRNA
Unitrap ID UNI6372

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20139246..20139675 430
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]

 
Come back to gene ENSMUSG00000044066


For any suggestions or comments, please send an email to unitrap@crg.es