Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST200212
Clone ID OST200212
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST200212
Sequence
GACTGAGATGCGAGCTACACCTCTGGCTGCTTNTGCTGATGTTTCTCTGCAGGAAGAAACCGTTGGAGTTTGNTGACAAT
ATTGATGCCAAGTGTCCAGTCCTAAAACGAGTGAGAGATGAGCCTGAGCCCGGACCACTCCCCAGCCTGCTGCCCCCCAG
CCCACCTCCCGCCTCAGACTTGTCACCTGCTGTGGCCCCTGCAACTCGACTGGGGCCTTATATCCTTTTGGAACGAGAGC
AAGGCAGCTGCAGCTATCGAGCCCTGCACTGCCCCACAGGCACAGAGTACACCTGCAAGGTGTACCCCGCCAGCGAGGCC
CAGGCGGTGCTGGCACCTTATGCCCGGCTGCCTACACACCAGCATGTGGCCCGTCCCACAGAGGTCCTGCTGGGCTCTCG
GCTCCTTTACATCTTTTTCACGAAGACCCATGGGGACTTGCACAGCCTGGTGCGCAGCCGCCGCGGTATCCCCGAGTCCG
AGGCTGCCGGGCTCTTCCGGCAGATGGCTAGTGCCGTGGCACACTGCCACAAGCACGGGCTTTG
Sequence Type mRNA
Unitrap ID UNI22234

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152165501..152169065 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032715 (Trib3) NM_175093 tribbles homolog 3 (Drosophila) Gene [Source:MGI (curated);Acc:Trib3-001]

 
Come back to gene ENSMUSG00000032715


For any suggestions or comments, please send an email to unitrap@crg.es