Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC108
Clone ID YHC108
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC108
Sequence
CCGGGGCGGCGAACAACGTGGAGTCGGGCGACTCTGGAGCTTGGATTTAGCGGCTCGCGGGCTCCGTACGCCTTGCGCTT
TCAGTGAAACAGGAAAAGATGATGAGTGATTTCGGTGAA
Sequence Type mRNA
Unitrap ID UNI6265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 362341..364289 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072258 (Taf1a) NP_067441 TATA box binding protein (Tbp)-associated factor, RNA polymerase I, A Gene [Source:MGI Symbol;Acc:MGI:109578]

 
Come back to gene ENSMUSG00000072258


For any suggestions or comments, please send an email to unitrap@crg.es