Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST200127
Clone ID OST200127
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST200127
Sequence
GACTGAGTAAAGATGGCGACGCCGTGAGTAAGTGACAAGCAACTGCACTTCCGCAGTTTTCCTGCTCCCTGGTCCAAGAT
GGCGGACGAGGCCACCTCGGCGGGTCGTGTCTGAGATCCCGGTGCTGAAGACCAACGCCGGACCCCGAGATCGGGAATTG
TGGGTGCAGCGACCTAAAGGAGGAATATCAGTCCCTGATCCGGTATGTGGAGAACAACAAGAATTCGGACAATGATTGGT
TCCGACTGGAGTCCAACAAGGAAGGGACCCGGTGGTTTGGAAAATGCTGGTACATCCACGATTTCCTCAAATATGAGNTC
GACATCGAGTTTGAAATTCCTATCACATATCCCACTACCTGCTCCGGAAATTGCAGTCCCTGAGCTGGACGGGAAGACAG
CAAAGATGTACAGGGGTGGCAAAATATGTCTGACTGATCATTTCAAACCTTTGTGGGCCAGGAATGTGCCTAAGTTTGGA
CTAGCTCATCTCATGGCCCTGGGGCTGGGTCCTTGGCTGGCAGTGGAAGTCCCCGATCTGATCC
Sequence Type mRNA
Unitrap ID UNI18370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173219063..173224960 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062963 (Ufc1) NM_025388 ubiquitin-fold modifier conjugating enzyme 1 Gene [Source:MGI (curated);Acc:Ufc1-001]

 
Come back to gene ENSMUSG00000062963


For any suggestions or comments, please send an email to unitrap@crg.es