Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC209
Clone ID YHC209
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC209
Sequence
TGCAGACGCGGGCCCGCCATGGAGCACATCCGTACGCCCAAGGTTGAAAACGTGCGCTTGGTAGACAGAGTGTCTTGTAA
AAAGGCAGCGCTGGGAACTTTGTATCTGACGGCCACTCACGTCATATTCGTGGAAAATGCAC
Sequence Type mRNA
Unitrap ID UNI6384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41694271..41720093 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]

 
Come back to gene ENSMUSG00000039431


For any suggestions or comments, please send an email to unitrap@crg.es