Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC020
Clone ID YHC020
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC020
Sequence
GGGTCGTGCGCGCTGAGGAGGAGCCGCAGCCGTCGCCGTCGCCGTCGCCGCTACCGCTACCGCTCTGCCGCCGCCGCCGC
CGCCGCCACCGCTGCCGAGGCCGTGCGGAGCCGTTATCGCCGCGCCGCCCGCCCCGGAGCAGAGTCCCGGGCCTTCCCGC
CCGTGTTCAGATTTTTAAATAATACAATGTCTAATGGTTATGAAGACCACATGGCGGAAGACTGCAGGGATGACATTGGG
AGAACGAATTTAATTGTCAACTACCTCCCTCAGAACATGACCCAAGAGGAACTACGAAGTCTGTTCAGCAGCATTGGCGA
GGTTGAATCTGCAAAGCTTATTCGGGATAAAGTAG
Sequence Type mRNA
Unitrap ID UNI6389

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4311602..4325033 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040028 (Elavl1) NM_010485 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene [Source:MGI Symbol;Acc:MGI:1100851]

 
Come back to gene ENSMUSG00000040028


For any suggestions or comments, please send an email to unitrap@crg.es