Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST199722
Clone ID OST199722
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST199722
Sequence
GATCATGTCGGAGTTCACTGCGNNNCCCTNAGGCACTGGCCATAGGCCAGCANAAGCCCCTTNGGNTGNGCTTTTACGAC
NTGGAACGGACCCTGGGCAAAGGCAATTTTGCAGTGGTTAAGCTGGCGCGGCACCGAGTNACCAAAACGCAGGTTGCGAT
AAAAATAATTGACAAGACACGGTTAGATTCTAGCAATCGTGGAGAAGATCTACCGGGAGGTCCAGCTCATGAAACTTCTG
AACCACCCAAATATCATCAAGCTTTATCAGGTTATGGAGACAAAGGATATGCCTCTACATTGTCACAGAATTTGCAAAAA
AAAAAA
Sequence Type mRNA
Unitrap ID UNI24958

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31988492..31991989 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024042 (Snf1lk) NM_010831 SNF1-like kinase Gene [Source:MGI Symbol;Acc:MGI:104754]

 
Come back to gene ENSMUSG00000024042


For any suggestions or comments, please send an email to unitrap@crg.es