Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0373
Clone ID GC0373
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0373
Sequence
AGCATGTCCTGGGTCTCGTCGATGAGCTTGGTCCTCTGCAGCACCAGCTTCCGCAAGCACAGGTACCCATTCAGCACAGT
GCCCACTAAGCGGCTCTTAAAATGCCTCTTAATGGATTCCACCTCTACAAAGGAGGAGAGAAGGCCTGTGAGACTCTTGA
GGGCATATCCCTGCTGCAGGTCTGTGCTCA
Sequence Type mRNA
Unitrap ID UNI89

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 139020911..139021353 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066036 (Ubr4) ubiquitin protein ligase E3 component n-recognin 4 Gene [Source:MGI (curated);Acc:Ubr4-001]

 
Come back to gene ENSMUSG00000066036


For any suggestions or comments, please send an email to unitrap@crg.es