Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST199655
Clone ID OST199655
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST199655
Sequence
TACAAGTTCAAGTCGCCGTAGTATTTGGTACAAAAATATTAGACGTATGTCTTCAACCTGTGCGAAGGTAAATTTGACTA
CCTGGAGCGGCTCTCCGACAGACTGCTGCTGAAGATCATCTGCTACCTGGACCTGGAAGATATTGCCAGCCTCTCCCAGA
CATCAAGCAAGTTTGAGAAGTTGTGCAAGAGTGACTTGCTGTGGGAACAGATAGTCCAGTCCACCTGTGACACCATCACC
CCTGACATGCGGGCCTTGGCGAAAAACATGGGCTGGAGGCAGATGTTCCTCACCAACAACATCCAGCTCCAGAGGCAGAC
CCGCAAGAAGAAGCAAAGACAGGAAAACCAGGCAGAGAAGCTTGCTTAGGGGATGGCTGTTTCCAACAGCGGAGCCACAG
TGGTCCGAATCTCCAGGTCCAAAGCTCACTCTCTCT
Sequence Type mRNA
Unitrap ID UNI13863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84893063..84896827 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es