Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST199633
Clone ID OST199633
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST199633
Sequence
GGCCATAATTACCACTGANCTAAAATNCCCACTTAATGTGTAGTCCTGTGTGGAGGGTACTTCATTGANGCCNCTACCAT
AATAGAATGTCTACATTCCTTCTGTAAAACATGTATTGTACAGTTACTTGGAGACCAGCAAGTATTGTCCTATTTGTGAT
GTCCAGGTTCACAAAACCAGACCACTCCTGAACATAAGGTCAGATAAAACTCTTCAAGATATTGTATACAAATTAGTCCC
AGGGCTTTTCAAAAATGAGATGAAGAGAAGAAGAGATTTTTATGCAGCTCACCCGTCAGCTGATGCTGCCAATGGCCCCA
ATGAAGACCGAGGAGAAGTTGCNGATGAGGAGAAGAGGATTNTAACNCGNTGATGAGATAATAAGCTTGTCCTATTGAGT
TCTTTGATCAACAGCANATTGGATNGCAAAGNNAATANACACAACCCTAANGAANAGGTGAATGATAAAAGGNACTTACN
ATGCCCAGCCAGCCATNACTGTGATGCACCTTGGAGAAAGG
Sequence Type mRNA
Unitrap ID UNI24960

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18603465..18605351 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026739 (Bmi1) NM_007552 Bmi1 polycomb ring finger oncogene Gene [Source:MGI (curated);Acc:Bmi1-001]

 
Come back to gene ENSMUSG00000026739


For any suggestions or comments, please send an email to unitrap@crg.es