Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST199612
Clone ID OST199612
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST199612
Sequence
ACTTGAGGTTTTTGAATCCAGTGAAGAATCCGGGGAGTCTTGTCCTCACGNGCGTTGTNTCAGGTCACTTCTTCNTTTCC
CAAGGGCAGACACTGCTGGAAGGGTTTTCACTCATTGGCAGCAAGANCTGGTTGAAGANTGTAAGACGCATGGACTGTCT
TCTGTTTGGAACAACAATAAAGAACAAGAGCCGAATGTTTCGTGTCCAGTTTAGTGGGGAGTCCAAGGAAGAGGCGCTGG
AGCGCTGCTGTGGCTGTGTGCAGACCCTGGCCCAGTACGTCACCGTTCAGGAGCCTGACAGCACCACCCAGGAGCTTCAG
CAGAGCCAAGGCCCCCGGGAGGCAGGTGAAAGCCAAGGGAAGGACCCACTGCANCAGGGGCCCTCCCTGACCCTGGAGCA
GCACGTGTGTATGGCAGCTGGGGCAGGTGTTCTACAGGAAAGGACCTNAGTGACACATCGAGNTCAGTCTATCCTGGCGC
CAGAGAAGCTGACCCTCGCCTATGAAGGCTCTTCATGGGGAACAGAA
Sequence Type mRNA
Unitrap ID UNI24961

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58500854..58559919 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074269 (2410076I21Rik) RIKEN cDNA 2410076I21 gene Gene [Source:MGI Symbol;Acc:MGI:1920923]

 
Come back to gene ENSMUSG00000074269


For any suggestions or comments, please send an email to unitrap@crg.es