Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC070
Clone ID YHC070
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC070
Sequence
CAACCTCGTAACCAGGGAAGAGCGGAGGATCACATACGTACACAAT
Sequence Type mRNA
Unitrap ID UNI6402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64893550..64893594 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032393 (Dpp8) NM_028906 dipeptidylpeptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1921638]

 
Come back to gene ENSMUSG00000032393


For any suggestions or comments, please send an email to unitrap@crg.es