Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC081
Clone ID YHC081
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC081
Sequence
GTAAGGCTCAGCGGCCGCCGCGGCAACAAGTGCTGGAGCTGTGGCGAGCCGGAGCCGCCCAGACCCCGCCGGGCCGCCCG
TCCGCGCATTGCGCATGGAGCGAGAGCGGCGGCGGTCGCGGGGCTGAGCCGCAAGAGCGGCTGGGACGTGGATGCGGCCG
CGGTCTTCCGCCCCGCCCCGCCGAGCTGGAGGTGTCCCTAGACA
Sequence Type mRNA
Unitrap ID UNI6407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22759496..22759699 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051650 (B3gnt2) NM_016888 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI (curated);Acc:B3gnt2-002]

 
Come back to gene ENSMUSG00000051650


For any suggestions or comments, please send an email to unitrap@crg.es