Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST198755
Clone ID OST198755
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST198755
Sequence
GACGTCTGGGGAGCTCCTGCATTAAGTCAGACTGAGGAGCAGGCTGCCCGTCTGAAGAAACTACAAGAGCAAGACAAACA
GCAGAAAGTGGAGTTTCGGAAAAGGATGGAGAAAGAGGTGTCTGATTTCATCCAGGACAGTGGACAGGTCAAGAAAAAGT
TTCAGCCTATGAACAAGATAGAGCAGGAGCATACCTACATGATGTGGTAGAGGTGGCTGGCCTCACATCCTTCTCCTTTG
GAGAAGATGATGACTGTCGCTATGTCATGATCTTCAAAAAGGAGTTTGCACCCTCAGATGAAGAGCTAGACTCCTACCGT
CATGGAGAGGAGTGGGACCCCCAGAAGGCTGAGGAGAAGCGGAAGCTAAAGGAGCTGGCTCAGAAGCAGGAGGAAGAGGC
AGCGCAGCAGGGACCTGCGGTTGTGAGTCCTGCCAGCGACTACAAGGACAAGTATAGCCATCTTATTGGCAAAGGAGCAG
CCAAAGATGCAGCCCACATGCTACAGGCCAACAAGACCTATGGCTGTGTTCCTGTGGCCAACAAGCGGGACACACGGTCA
Sequence Type mRNA
Unitrap ID UNI10427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70477692..70478867 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018287 (Spag7) NM_172561 sperm associated antigen 7 Gene [Source:MGI (curated);Acc:Spag7-001]

 
Come back to gene ENSMUSG00000018287


For any suggestions or comments, please send an email to unitrap@crg.es